Review



manuscript n a a549 ace2 lamp1 egfp  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC manuscript n a a549 ace2 lamp1 egfp
    Manuscript N A A549 Ace2 Lamp1 Egfp, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 9098 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/manuscript+n+a+a549+ace2+lamp1+egfp/A549/pm37421942-673-67-74
    Average 99 stars, based on 9098 article reviews
    manuscript n a a549 ace2 lamp1 egfp - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    RNA Sequencing:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Microscopy:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Western Blot:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Quantitative RT-PCR:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Recombinant:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Expressing:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..

    Software:

    Article Title: Enhanced SARS-CoV-2 entry via UPR-dependent AMPK-related kinase NUAK2.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-GADD34 Proteintech Cat# 10449-1-AP; RRID: AB_2168724 Anti-p-eIF2a Cell Signaling Cat# 3398; RRID: AB_2096481 Anti-eIF2a Cell Signaling Cat #9722; RRID: AB_2230924 Anti-ATF6 Biolegend Cat# 853101; RRID: AB_2728605 Anti-PERK Cell Signaling Cat #3192; RRID: AB_2095847 Anti-IRE1a Cell Signaling Cat #3294; RRID: AB_823545 Anti-Nucleocapsid (mouse monoclonal) Sino Biological Cat# 40143-MM05; RRID: AB_2827977 Anti-Nucleocapsid (rabbit polyclonal) Rockland Cat# 200-401-A50; RRID: AB_828403 Anti-ß-Actin Sigma Aldrich Cat# A5441; RRID: AB_476744 Anti-HA ThermoFisher Cat# PA1-985; RRID: AB_559366 Anti-HA Abgent Cat# AP1012a; RRID: AB_352510 Anti-ACE2 Proteintech Cat# 21115-1-AP; RRID: AB_10732845 Anti-GAPDH ThermoFisher Cat# PA1-987; RRID: AB_2107311 Anti-Nucleocapsid HCoV-229E (rabbit polyclonal) Sino Biological Cat# 40640-T62 Anti-actin mAb Cytoskeleton Inc. Cat# AAN02-S; RRID: AB_2884962 Alexa Fluor 488 donkey anti-rabbit IgG ThermoFisher Cat# A-21206; RRID: AB_2535792 Alexa Fluor 488 donkey anti-mouseIgG ThermoFisher Cat# A-21202; RRID: AB_141607 Alexa Fluor 568 donkey anti-rabbit IgG ThermoFisher Cat# A-10042; RRID: AB_2534017 Alexa Fluor 568 donkey anti-mouse IgG ThermoFisher Cat# A-10037; RRID: AB_2534013 DAPI MoBiTec Cat# MFPCCFA-211 Alexa Fluor Plus 647Wheat GermAgglutinin ThermoFisher Cat# W32466 Alexa Fluor Plus 647 Phalloidin ThermoFisher Cat# A22287 Lipidtox ThermoFisher Cat# H34477 Bacterial and virus strains SARS-CoV-2 isolate Bavpat1/2020 Christian Drsoten via European Virology Archive SKU:026V-03883 SARS-CoV-2 B.1.1.529.1 (Omicron isolate) Isolate from a patient at Heidelberg University Hospital N/A HCoV-229E Volker Thiel, University of Bern, Switzerland N/A Chemicals, peptides, and recombinant proteins DTT Sigma Aldrich D0632 WZ-4003 Sigma Aldrich SML1445 Thapsigargin Sigma Aldrich T9033 Cycloheximide Sigma Aldrich 1810 Latrunculin B Sigma Aldrich L5288 Jasplakinolide Sigma Aldrich J4580 Rhodamin B-octadecylester perchlorate Sigma Aldrich 83685 ISRIB Sigma Aldrich SML0843 4m8C Sigma Aldrich SML0949 Caepin A7 Sigma Aldrich SML2330 APY29 Sigma Aldrich SML2381 Recombinant Spike RnD Systems 10549-CV-100 (Continued on next page) e1 Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER AMG18 Sigma Aldrich SML2903 Deposited data RNA Sequencing Data Nucleotide Archive PRJEB51271 Analysis code and scripts Github Repository archived at Zenodo https://doi.org/10.5281/zenodo.8032946 Microscopy Images and Western Blot Images - Dataset 1 Mendeley Data https://doi.org/10.17632/jsbnp3nyv3.1 Microscopy Images and Western Blot Images - Dataset 2 Mendeley Data https://doi.org/10.17632/cg8cj9hw3w.1 Experimental models: Cell lines HEK293T ATCC #CRL-3216 A549-ACE2 Cortese et al.17 N/A A549-ACE2-TMPRSS2 (Rosa promoter) This manuscript N/A A549-ACE2-LAMP1-EGFP This manuscript N/A Calu-3 ATCC #HTB-55 Huh7/Lunet-T7-ACE2 Tabata et al.18 N/A Huh7/Lunet-T7-ACE2-tet-mNG-IRE1a This manuscript N/A A549-ACE2-HA-NUAK2 This manuscript N/A Oligonucleotides RT-qPCR XBP1 Forward Prasad et al.32 N/A RT-qPCR XBP1 Reverse Prasad et al.32 N/A RT-qPCR SARS-CoV-2 Orf1a Forward: GAGAGCCTTGTCCCTGGTTT Tabata et al.18 N/A RT-qPCR SARS-CoV-2 Orf1a Reverse: AGTCTCCAAAGCCACGTACG Tabata et al.18 N/A RT-qPCR NUAK2 Forward: CCCCGCACAGCCTACTGATT This manuscript N/A RT-qPCR NUAK2 Reverse: ACTTGATCAGCCCTTCCGC This manuscript N/A Recombinant DNA tet-IRE1a-mNG This manuscript (Inducible expression of mammalian IRE1a as a fusion protein with mNG) N/A pLVX-HA-NUAK2-IRES-Puro This manuscript (expression of mammalian NUAK2 as a Nterminal HA-tag) N/A pTM-SARS-CoV-2-NG-HA-Nsp3-4-V5 Tabata et al.18 N/A Software and algorithms Analysis code for RNA sequencing data analysis GitHub https://github.com/boutroslab/ Supp_Prasad_2022 ilastik Berg et al.62 https://www.ilastik.org FIJI https://imagej.nih.gov/ij/ CellProfiler Broad Institute, USA https://cellprofiler.org CellProfiler Analyst Broad Institute, USA https://cellprofileranalyst.org IMOD ver 4.10.42 Kremer et al.63 https://bio3d.colorado.edu/imod/ Drishti 2.6.4 Limaye64 https://github.com/nci/drishti/ Serial EM Mastronarde65 https://bio3d.colorado.edu/SerialEM/ Molecular Cell 83, 2559–2577.e1–e8, July 20, 2023 e2 ..



    Similar Products

    manuscript n a a549 ace2 lamp1 egfp  (ATCC)
    99
    ATCC manuscript n a a549 ace2 lamp1 egfp
    Manuscript N A A549 Ace2 Lamp1 Egfp, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/manuscript+n+a+a549+ace2+lamp1+egfp/A549/pm37421942-673-67-74
    Average 99 stars, based on 1 article reviews
    manuscript n a a549 ace2 lamp1 egfp - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results